E-mail alert
Rss
Transformation of ammonium nitrogen and response characteristics of nitrifying functional genes in tannery sludge contaminated soil
-
Abstract: High concentrations of ammonium nitrogen released from tannery sludge during storage in open air may cause nitrogen pollution to soil and groundwater. To study the transformation mechanism of NH4+-N by nitrifying functional bacteria in tannery sludge contaminated soils, a series of contaminated soil culture experiments were conducted in this study. The contents of ammonium nitrogen (as NH4+-N), nitrite nitrogen (as NO2−-N) and nitrate nitrogen (as NO3−-N) were analyzed during the culture period under different conditions of pollution load, soil particle and redox environment. Sigmodial equation was used to interpret the change of NO3−-N with time in contaminated soils. The abundance variations of nitrifying functional genes (amoA and nxrA) were also detected using the real-time quantitative fluorescence PCR method. The results show that the nitrification of NH4+-N was aggravated in the contaminated silt soil and fine sand under the condition of lower pollution load, finer particle size and more oxidizing environment. The sigmodial equation well fitted the dynamic accumulation curve of the NO3−-N content in the tannery sludge contaminated soils. The Cr(III) content increased with increasing pollution load, which inhibited the reproduction and activity of nitrifying bacteria in the soils, especially in coarse-grained soil. The accumulation of NO2−-N contents became more obvious with the increase of pollution load in the fine sand, and only 41.5% of the NH4+-N was transformed to NO3−-N. The redox environment was the main factor affecting nitrification process in the soil. Compared to the aerobic soil environment, the transformation of NH4+-N was significantly inhibited under anaerobic incubation condition, and the NO3−-N contents decreased by 37.2%, 61.9% and 91.9% under low, medium and high pollution loads, respectively. Nitrification was stronger in the silt soil since its copy number of amoA and nxrA genes was two times larger than that of fine sand. Moreover, the copy numbers of amoA and nxrA genes in the silt soil under the aerobic environment were 2.7 times and 2.2 times larger than those in the anaerobic environment. The abundance changes of the amoA and nxrA functional genes have a positive correlation with the nitrification intensity in the tannery sludge-contaminated soil.
-
Figure 1. Transformation of ammonium nitrogen in contaminated silt soil and fine sand under different pollution loads
(A：FW1；B：SW1；C：FW2；D：SW2；E：FW3；F：SW3)
Figure 2. Richness characteristics of amoA and nxrA genes in silt soil under different pollution loads
(A: amoA；B: nxrA; different lowercases indicate significant differences between the data (P < 0.05))
Figure 3. Richness characteristics of amoA and nxrA genes in silt soil and fine sand under low pollution load
(A: amoA；B: nxrA; different lowercases indicate significant differences between the data (P < 0.05))
Figure 4. Transformation of ammonia nitrogen in contaminated silt soil under anaerobic condition
（A: OFW1; B: OFW2; C: OFW3）
Figure 5. Genes richness characteristics of amoA and nxrA under different redox condition
(A: amoA；B: nxrA; different lowercases indicate significant differences between the data (P < 0.05))
Figure 6. S-growth fitting curve of nitrate accumulation process under different environmental condition
(A: pollution load; B: soil texture; C: redox condition)
Table 1. Basic physical and chemical properties of the tannery sludge and soil
Type TOC(%) pH CEC(mol/kg) Fe2O3(%) Cr(III)(mg/kg) NH4+-N(mg/kg) NO3−-N(mg/kg) Silt soil 0.17 7.61 13.6 6.13 35 20 <5 Fine Sand 0.09 7.25 9.75 3.48 17 12 <5 Tannery Sludge 14.3 7.67 - - 30800 16500 500 
下载: 导出CSV
Table 2. Culture conditions of tannery sludge contaminated soils
Type Sample Culture condition Sample Culture condition Tannery contaminated-Silt soil FW1 Aerobic, Sludge addition 15% OFW1 Anaerobic, Sludge addition 15% FW2 Aerobic, Sludge addition 30% OFW2 Anaerobic, Sludge addition 30% FW3 Aerobic, Sludge addition 50% OFW3 Anaerobic, Sludge addition 50% Tannery contaminated-Fine Sand SW1 Aerobic, Sludge addition 15% SW2 Aerobic, Sludge addition 30% SW3 Aerobic, Sludge addition 50%
下载: 导出CSV
Table 3. Quantitative PCR primer and reaction procedure
Objective Genes Segment Site Sarter Sequence（5’-3’） Reaction procedure / Condition amoA 491 AmoA-1F GGGGTTTCTACTGGTGGT 95°C for 3 min × 1cycle AmoA-2R CCCCTCKGSAAAGCCTTCTTC 95°C for 30 s，56°C for 30 s，72°C for 40 s×35cycles nxrA 324 F1norA CAGACCGACGTGTGCGAAAG 95°C for 3 min × 1cycle R1norA TCYACAAGGAACGGAAGGTC 95°C for 30 s，56°C for 30 s，72°C for 40 s×35cycles
下载: 导出CSV
Table 4. Sigmodial fitting parameters of nitrate accumulation process under different environment conditions
Reaction Condition A1 A2 t0
（d）A2-A1
（mg/kg）（A2-A1）/(4dt)
（mg/kg·d）R2 FW1 0.45 180.09 37.79 179.64 12.72 0.988 FW2 11.01 387.42 39.23 376.41 32.56 0.999 FW3 1.21 761.89 51.71 760.68 34.39 0.997 SW2 1.39 307.43 47.83 306.04 15.61 0.966 OFW2 0.54 145.68 49.71 145.14 5.87 0.999
下载: 导出CSV
-
An LR, Bian WX, Liu BH, et al. 2021. Advances in the effects of environmental stress on ammonia-oxidizing communities. Chinese Journal of Applied and Environmental Biology, 27(3): 8. (in Chinese) doi: 10.19675/j.cnki.1006-687x.2020.03005 Araujo ASF, de Melo WJ, Araujo FF, et al. 2020. Long-term effect of composted tannery sludge on soil chemical and biological parameters. Environmental Science and Pollution Research, 27: 41885−41892. doi: 10.1007/s11356-020-10173-9 Daims H, Lebedeva E, Pjevac P, et al. 2015. Complete nitrification by nitrospira bacteria. Nature, 528 (7583): 504−509. doi: 10.1038/nature16461 Guo SS, Wu H, Tian YQ, et al. 2021. Migration and fate of characteristic pollutants migration from an abandoned tannery in soil and groundwater by experiment and numerical simulation. Chemosphere, 271(8): 129552. doi: 10.1016/j.chemosphere.2021.129552 Han KQ, Duan RS, Jia LL, et al. 2014. Analysis on present status of underground water pollution in Shijiazhuang and its prevention measures. Journal of Groundwater Science and Engineering, 2(1): 44−48. He JZ, Shen JP, Zhang LM, et al. 2012. A review of ammonia-oxidizing bacteria and archaea in Chinese soils. Front Microbiology, 3(296): 296. (in Chinese) doi: 10.3389/fmicb.2012.00296 Ke XB, Lu W, Conrad R. 2015. High oxygen concentration increases the abundance and activity of bacterial rather than archaeal nitrifiers in rice field soil. Microb Ecology, 70: 961−970. doi: 10.1007/s00248-015-0633-4 Kong XK, Huang GX, Han ZT, et al. 2017. Vertical distribution characteristics of pollutants in a typical soil profile in the tannery sludge landfill site. South-to-North Water Transfers and Water Science & Technology, 15(06): 96-100. (in Chinese) Kong XK, Li CH, Wang P, et al. 2019. Soil pollution characteristics and microbial responses in a vertical profile with long-term tannery sludge contamination in Hebei, China. Int. J. Environ. Res. Public Health, 16(4): 563. doi: 10.3390/ijerph16040563 Kong XK, Wang YY, Ma LS, et al. 2020. Leaching behaviors of chromium (III) and ammonium-nitrogen from a tannery sludge in North China: Comparison of batch and column investigations. International Journal of Environmental Research and Public Health, 17(16): 6003-6014. Liu G, Wang J. 2013. Long-term low DO enriches and shifts nitrifier community in activated sludge. Environmental Science & Technology, 47(10): 5109−5117. doi: 10.1021/es304647y Liu GH, Chen Y, Fan Q, et al. 2016. Effects of dissolved oxygen concentration on nitrogen removal and nitrifying bacterial community structure in an activated sludge system. Acta Scientiae Circumstantiae, 36(6): 8. (in Chinese) doi: 10.13671/j.hjkxxb.2015.0709 M Barajas-Aceves, JD Rios-Berber, JL Oropeza-Mota, et al. 2014. Assessment of tannery waste in semi-arid soils under a simulated rainfall system. Soil and Sediment Contamination: An International Journal, 8(23): 954−964. doi: 10.1080/15320383.2014.896861 Ma H, Zhou J, Hua L, et al. 2017. Chromium recovery from tannery sludge by bioleaching and its reuse in tanning process. Journal of Cleaner Production, 142: 2752-2760. Martines AM, Nogueira MA, Santos CA, et al. 2010. Ammonia volatilization in soil treated with tannery sludge. Bioresource Technology, 101(12): 4690−4696. doi: 10.1016/j.biortech.2010.01.104 Mohamad JM, Xi L, Przemyslaw K, et al. 2021. Incorporation of the complete ammonia oxidation (comammox) process for modeling nitrification in suspended growth wastewater treatment systems. Journal of Environmental Management, 11(297): 113−223. Nakatani AS, Martines AM, Nogueira MA, et al. 2011. Changes in the genetic structure of bacteria and microbial activity in an agricultural soil amended with tannery sludge. Soil Biology and Biochemistry, 43(1): 106−114. doi: 10.1016/j.soilbio.2010.09.019 Pantazopoulou E, Zouboulis A. 2017. Chemical toxicity and ecotoxicity evaluation of tannery sludge stabilized with ladle furnace slag. Environ Manage, 216(15): 257−262. doi: 10.1016/j.jenvman.2017.03.077 Pettridge J, Petersen DG, Nuccio E, et al. 2013. Influence of oxic/anoxic fluctuations on ammonia oxidizers and nitrification potential in a wet tropical soil. FEMS Microbiology Ecology, 85(1): 179−194. Ramírez-Díaz MI, Díaz-Pérez C, Vargas E, et al. 2008. Mechanisms of bacterial resistance to chromium compounds. Biometals, 21(3): 321−332. doi: 10.1007/s10534-007-9121-8 Rovita D, Killorn R. 2008. Heavy‐Metal Inhibition of Nitrification in Selected Iowa Soils Treated with Stay‐N 2000. Communications in Soil Science and Plant Analysis, 39(7) : 972−982. Sabey BR, Frederick LR. 1959. The formation of nitrate from ammonium mitrogen in soils: III. Influence of temperature and initial population of nitritying organisms on the maximum rate and delay period. Proceedings - Soil Science Society of America, 23: 462−465. Smolders E, Brans K, Coppens F, et al. 2001. Potential nitrification rate as a tool for screening toxicity in metal-contaminated soils. Environmental Toxicology & Chemistry, 20(11): 2469−2474. Wang PC. 2018. The effect of cadmium levels on nitrogen transformation in the soil—plant system and the microbial mechanism exploration. Wuhan: Huazhong Agricultural University. (in Chinese). DOI:CNKI: CDMD:1.1018.206931 Wendeborn S. 2020. The chemistry, biology, and modulation of ammonium nitrification in soil. Angewandte Chemie International Edition, 59(6): 2182−2202. doi: 10.1002/anie.201903014 Xu JY, Mao YP. 2019. From canonical nitrite oxidizing bacteria to complete ammonia oxidizer: Discovery and advances. Microbiology China(4): 12. (in Chinese) doi: 10.13344/j.microbiol.china.180194 Yu H, An YJ, Jin DC, et al. 2021. Effects of chromium pollution on soil bacterial community structure and assembly processes. Environmental Science, 42(03): 1197−1204. (in Chinese) . Yuan QX, Wu YJ, Ai P, et al. 2007. Effects of moisture, temperature and nitrogen supply rate on NO3−-N accumulation in greenhouse soil. Transactions of the Chinese Society of Agricultural Engineering(10): 192−198. (in Chinese) Zeng J, Gou M, Tang Y, et al. 2016. Effective bioleaching of chromium in tannery sludge with an enriched sulfur-oxidizing bacterial community. Bioresource Technology, 218(12): 859−866. doi: 10.1016/j.biortech.2016.07.051 Zheng GY, Zhou LX. 2011. Supplementation of inorganic phosphate enhancing the removal efficiency of tannery sludge-borne Cr through bioleaching. Water Research, 45(16): 5295-5301. Zou DA, Chi Y, Dong J, et al. 2013. Supercritical water oxidation of tannery sludge: Stabilization of chromium and destruction of organics. Chemosphere, 93(12): 1413−1418. doi: 10.1016/j.chemosphere.2013.07.009 -
点击查看大图
图(6) / 表ll (4)
计量
- 文章访问数: 587
- HTML全文浏览量: 253
- PDF下载量: 33
- 被引次数: 0
